SGN Marker C2_At3g15190

SGN-M7746
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301494 (SGN)
124467 (CGN)
---
Capsicum annuumSingleSGN-U200183---
Lycopersicon CombinedSingleSGN-U215907---
Solanum tuberosumMultipleSGN-U245219---
ArabidopsisSingleAt3g15190 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26174)
Chromosome
3
Position
5.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41388
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
Accessions and product sizes
Solanum lycopersicum TA209
2300
Solanum pennellii TA56
2300
Approximate temperature
53°C
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
720
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11052
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2300
Approximate temperature
53°C
  
PCR data   Exp. ID 11053
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2300
Approximate temperature
53°C
  
PCR data   Exp. ID 11054
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2300
Approximate temperature
53°C
  
PCR data   Exp. ID 13211
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 13212
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 13213
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 13214
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 13215
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 32633
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 33021
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 33022
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 33023
Forward primer (5'-3')
ATTTACCACAAGGCTAAAAAATCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTCTCCAATGCTTCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 2500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g15190  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7746 marker 7746
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)