SGN Marker C2_At3g15430

SGN-M7749
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310705 (SGN)
130829 (CGN)
---
Lycopersicon CombinedSingleSGN-U219285---
Solanum tuberosumMultipleSGN-U247068---
ArabidopsisSingleAt3g15430 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109234)
Chromosome
2
Position
65.19 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Pepper-COSII   
Map version
58 (location: 41417)
Chromosome
7
Position
109.90 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43393
Forward primer (5'-3')
TCGTTTGAGGTCAACTTTAATGGAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTTGTTTCAGGCCCATGACCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38471)
Chromosome
7
Position
68.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39711
Forward primer (5'-3')
TCGTTTGAGGTCAACTTTAATGGAGG
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
AGTTGTTTCAGGCCCATGACCAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
180+200+300
Solanum lycopersicum TA209
200+500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26178)
Chromosome
3
Position
5.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11059
Forward primer (5'-3')
TCGTTTGAGGTCAACTTTAATGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTGTTTCAGGCCCATGACCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 11060
Forward primer (5'-3')
TCGTTTGAGGTCAACTTTAATGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTGTTTCAGGCCCATGACCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 11061
Forward primer (5'-3')
TCGTTTGAGGTCAACTTTAATGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTGTTTCAGGCCCATGACCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32407
Forward primer (5'-3')
TCGTTTGAGGTCAACTTTAATGGAGG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 920
Solanum lycopersicum LA925: 880
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTGTTTCAGGCCCATGACCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 880
Solanum pennellii LA716: 920
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g15430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7749 marker 7749
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)