Sol Genomics Network

SGN Marker C2_At3g15430

SGN-M7749
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	310705 (SGN) 130829 (CGN)	-	-	-
Lycopersicon Combined	Single	SGN-U219285	-	-	-
Solanum tuberosum	Multiple	SGN-U247068	-	-	-
Arabidopsis	Single	At3g15430 on TAIR	-	-	-

Mapped locations

Map: Solanum michoacanum 2011
Map version 155 (location: 109234)
Chromosome 2
Position 65.19 cM
Confidence uncalculated
Protocol CAPS

Solanum michoacanum 2011

Map: Pepper-COSII
Map version 58 (location: 41417)
Chromosome 7
Position 109.90 cM
Confidence I
Protocol CAPS

Pepper-COSII

PCR data Exp. ID 43393

Forward primer (5'-3')

TCGTTTGAGGTCAACTTTAATGGAGG

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AGTTGTTTCAGGCCCATGACCAAG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Tomato-EXPEN 2000
Map version 52 (location: 38471)
Chromosome 7
Position 68.00 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39711

Forward primer (5'-3')

TCGTTTGAGGTCAACTTTAATGGAGG

Accessions and product sizes

Solanum pennellii TA56

700

Solanum lycopersicum TA209

700

Approximate temperature

55°C

Reverse primer (5'-3')

AGTTGTTTCAGGCCCATGACCAAG

Digested band sizes (using amplicon difference)

Solanum pennellii TA56

180+200+300

Solanum lycopersicum TA209

200+500

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26178)
Chromosome 3
Position 5.21 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 11059
Forward primer (5'-3') TCGTTTGAGGTCAACTTTAATGGAGG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTTGTTTCAGGCCCATGACCAAG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 920	Approximate temperature 55°C

PCR data Exp. ID 11060
Forward primer (5'-3') TCGTTTGAGGTCAACTTTAATGGAGG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTTGTTTCAGGCCCATGACCAAG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 880	Approximate temperature 55°C

PCR data Exp. ID 11061
Forward primer (5'-3') TCGTTTGAGGTCAACTTTAATGGAGG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTTGTTTCAGGCCCATGACCAAG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 1000	Approximate temperature 55°C

PCR data Exp. ID 32407
Forward primer (5'-3') TCGTTTGAGGTCAACTTTAATGGAGG	Digested band sizes (using amplicon difference) Solanum pennellii LA716: 920 Solanum lycopersicum LA925: 880	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGTTGTTTCAGGCCCATGACCAAG	Enzymes All possible enzymes for pennellii and and lycopersicum: amplicon difference
Accessions and product sizes Solanum lycopersicum LA925: 880 Solanum pennellii LA716: 920	Approximate temperature 55°C

Unigene blast matches for primers

SGN-U219285

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At3g15430

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7749 marker 7749

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer