SGN Marker C2_At3g17040

SGN-M7768
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U224982---
Solanum tuberosumSingleSGN-U250826---
ArabidopsisSingleAt3g17040 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109235)
Chromosome
4
Position
30.46 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51522)
Chromosome
4
Position
22.10 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tobacco N. acuminata   
Map version
89 (location: 46486)
Chromosome
4
Position
12.90 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41419)
Chromosome
5
Position
36.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43395
Forward primer (5'-3')
TGGGGTTGGATGGAGTGGAAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTAGAGGTTACGAATTTCCTCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38477)
Chromosome
4
Position
22.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39716
Forward primer (5'-3')
TGGGGTTGGATGGAGTGGAAAG
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
AGTAGAGGTTACGAATTTCCTCTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26198)
Chromosome
3
Position
5.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11079
Forward primer (5'-3')
TGGGGTTGGATGGAGTGGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAGAGGTTACGAATTTCCTCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 470
Approximate temperature
55°C
  
PCR data   Exp. ID 11080
Forward primer (5'-3')
TGGGGTTGGATGGAGTGGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAGAGGTTACGAATTTCCTCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 470
Approximate temperature
55°C
  
PCR data   Exp. ID 11081
Forward primer (5'-3')
TGGGGTTGGATGGAGTGGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAGAGGTTACGAATTTCCTCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 470
Approximate temperature
55°C
  
PCR data   Exp. ID 11082
Forward primer (5'-3')
TGGGGTTGGATGGAGTGGAAAG
Digested band sizes (using XbaI)
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 470
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAGAGGTTACGAATTTCCTCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,Tsp509I,XbaI
All possible enzymes for lycopersicum and pimpinellifolium: ApoI,BglII,BstYI,DpnII,Hpy188I,Tsp509I,XbaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 470
Solanum pennellii LA716: 470
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g17040F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At3g17040  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7768 marker 7768
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)