SGN Marker SSR104

SGN-M777

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 40
Repeat motif: AT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: TTCCATTTGAATTCCAACCC
Reverse primer: CCCACTGCACATCAACTGAC
Predicted size: 249
Derivations 
This marker was derived from EST read SGN-E170841
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39160)
Chromosome
2
Position
36.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32045
Forward primer (5'-3')
TTCCATTTGAATTCCAACCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCCACTGCACATCAACTGAC
Enzymes
  
Accessions and product sizes
Approximate temperature
40°C
  
Overgo hybridization and physical mapping 
SSR104 was used as an overgo probe on plate 10 [well G8]

Plausible BAC Matches:   P128B04,   P069G12,   P024J22,   P111G23,   P041K15,   P155C04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTTATGCATCCACGTGGAGCAAAC
B sequence
AGGAGCATCTCACACTGTTTGCTC
AB sequence
CTTATGCATCCACGTGGAGCAAACAGTGTG
Marker sequence
GGAGATGTAAGAAAAATATCCAAAAACCAATCTTTTGAAATCTTGAATTT
ACCCAATTTCTGTCGGAATTTTCGCTCAGATTTCCATTTGAATTCCAACC
CATTTTCAGATAATCTCAAGTACCCTTCACTGTATTTTTTTTTTTCGTGT
GTGGGGATATATATATATATATATATATTATAATAGAGGGGTACCCTATC
TTCCAGATTTGTTCATTGACTGGAAGAATAAATTTACCTCACAGATCGGC
AGAAATTAGCTCTTCTAACTCAGACGACTCGACATTCAAACAGATTGAAA
GATATGCAGAGTCAGTTGATGTGCAGTGGGTGCAGGACAATGCTTCTTTA
TCCCAGAGGAGCTTCTAATGTCTGCTGTGCAGTGTGCAATGCACTCACCC
CTGTCCCACCACCTGGAATGGAAATGGCTCAATTGATATGTGGAGGCTGT
CGTACATTACTTATGCATCCACGTGGAGCAAACAGTGTGAGATGCTCCTG
CTGTCATACGGTGAACCTTGTCCCAGGTCCAAACCAGTTTGCTCATGTCT
ACTGCGGGAACTGCCGTATGATGCTGATGTATCCATGTGGAGCTCCATTC
GGTTAATGTGCAGTATGCCATTATATTACCAATGTTAAT
Genomic location of SSR104  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D777 marker 777
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)