SGN Marker C2_At3g17590

SGN-M7775
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306801 (SGN)
127414 (CGN)
---
Lycopersicon CombinedSingleSGN-U216595---
Solanum tuberosumSingleSGN-U246420---
ArabidopsisSingleAt3g17590 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49245)
Chromosome
11
Position
6.42 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47180)
Chromosome
11
Position
62.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46671)
Chromosome
4
Position
43.80 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38479)
Chromosome
11
Position
43.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39718
Forward primer (5'-3')
TGTGAAGGATTTGAAACTTCCTCC
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCGCCAGTGTGCATATCTTGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26205)
Chromosome
3
Position
6.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g17590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7775 marker 7775
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)