SGN Marker SSR105

SGN-M778

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 52.632
Repeat motif: TC   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: GAGCGGCTTCGAATTCATC
Reverse primer: CATTTGAGCAGAAGCGAACA
Predicted size: 186
Derivations 
This marker was derived from EST read SGN-E169749
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43775)
Chromosome
1
Position
32.10 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44770
Forward primer (5'-3')
GAGCGGCTTCGAATTCATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CATTTGAGCAGAAGCGAACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43235)
Chromosome
1
Position
40.00 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44584
Forward primer (5'-3')
GAGCGGCTTCGAATTCATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CATTTGAGCAGAAGCGAACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40774)
Chromosome
1
Position
51.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008
Other PCR data 
PCR data   Exp. ID 31744
Forward primer (5'-3')
GAGCGGCTTCGAATTCATC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CATTTGAGCAGAAGCGAACA
Enzymes
  
Accessions and product sizes
Approximate temperature
52°C
  
Genomic location of SSR105  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D778 marker 778
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)