SGN Marker C2_At3g19630

SGN-M7799
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307066 (SGN)
130002 (CGN)
---
Capsicum annuumSingleSGN-U200295---
Lycopersicon CombinedMultipleSGN-U215043---
Solanum tuberosumSingleSGN-U256187---
ArabidopsisSingleAt3g19630 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41421)
Chromosome
1
Position
229.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43397
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38489)
Chromosome
1
Position
146.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39723
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
Accessions and product sizes
Solanum lycopersicum TA209
100
Solanum pennellii TA56
100
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26229)
Chromosome
3
Position
6.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11098
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11099
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11100
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13244
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13245
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 330
Approximate temperature
55°C
  
PCR data   Exp. ID 13246
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13247
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13248
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 350+600
Approximate temperature
55°C
  
PCR data   Exp. ID 13249
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350+600
Approximate temperature
55°C
  
PCR data   Exp. ID 13250
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350+600
Approximate temperature
55°C
  
PCR data   Exp. ID 13251
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13252
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 400+650
Approximate temperature
55°C
  
PCR data   Exp. ID 13253
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13254
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13255
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13256
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33033
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 33034
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 350+600
Approximate temperature
55°C
  
PCR data   Exp. ID 33035
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350+600
Approximate temperature
55°C
  
PCR data   Exp. ID 33036
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350+600
Approximate temperature
55°C
  
PCR data   Exp. ID 11101
Forward primer (5'-3')
ACGGGGTTACCACCAAGCTCC
Digested band sizes (using DraI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 190
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCATTTAATTTCCCCAAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, MspI, DraI
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g19630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7799 marker 7799
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)