SGN Marker C2_At3g19895

SGN-M7805
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311189 (SGN)
126721 (CGN)
---
Solanum tuberosumSingleSGN-U251228---
ArabidopsisSingleAt3g19895 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46676)
Chromosome
4
Position
22.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46488)
Chromosome
4
Position
6.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38492)
Chromosome
4
Position
19.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39724
Forward primer (5'-3')
TGGTGAGCTTCCTTCTGAAAATGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGAGAGCGGTACTGCAATCGAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26235)
Chromosome
3
Position
6.92 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g19895  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7805 marker 7805
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)