SGN Marker SSR108

SGN-M781

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 45
Repeat motif: TC   Repeat number: 6
Repeat motif: ACTCTC   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: TGTGTTGGATGTTTGGCACT
Reverse primer: GCCATTGAAACTTGCAGAGA
Predicted size: 217
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39161)
Chromosome
7
Position
0.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31917
Forward primer (5'-3')
TGTGTTGGATGTTTGGCACT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCCATTGAAACTTGCAGAGA
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR108 was used as an overgo probe on plate 1 [well A7]

Plausible BAC Matches:   P131C07,   P173F03,   P024K09,   P226P17,   P258H12,   P195G07,   P170F21,   P172F14,   P196N03,   P221K17,   P170I24

 Overgo Sequences

A sequence
TCCATCTCTTTGTGGGGACATTTC
B sequence
CAGAGAGAGAAATAGAGAAATGTC
AB sequence
TCCATCTCTTTGTGGGGACATTTCTCTATT
Marker sequence
TTAGTACAATTTTCATGAAGAATTGAAAATTGTATATATAAGTATTTGAG
AAGAAAAAAAAGTCTCTTTGAATTATGTTGTTAGAGTTGTGTTGGATGTT
TGGCACTTAATTTTAGATTTGCCAAACACTACATTTCTACTTTATTTCCC
TTTTTTCTTTGTGTGTGTTGGTGTTTTTGTAATTTTTACTATGCTAATGA
TTTAAGCATCTAAAAAAAAAAAAAAAAAACTCTCACTCTCTCTCTCTCTC
TCCATCTCTTTGTGGGGACATTTCTCTATTTCTCTCTCTGCAAGTTTCAA
TGGCTACTGAATTTGTCAACAAGATTCATCCTGAATACCCTCACATGATT
TATGAAGCCCTTGATGCATTGCAACAAAAAGAAGGCTCAAACAAGTCATC
AATATCAAAGTACATTGAATCTAAGTATGGAAACATGAATGATGCACACT
CAAAGTTGATAACTTACCATTTGGATAGAATGAAACAAACTGGTGAACTT
ATTTTCCTAAAAAACAACTACCTTAAACCTGGTCCAGATGCACCCCCTAA
GCGTGGCCGCGGCCGACCACCTAAACCCAAACCTTTATTGCCACAAGG
Genomic location of SSR108  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D781 marker 781
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)