SGN Marker SSR109

SGN-M782

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: TCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TATGGAACTCTGCACTTGCG
Reverse primer: AATCCAGCACCTCCATCAAG
Predicted size: 151
Derivations 
This marker was derived from EST read SGN-E80200
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43776)
Chromosome
5
Position
94.20 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44772
Forward primer (5'-3')
TATGGAACTCTGCACTTGCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCCAGCACCTCCATCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43236)
Chromosome
5
Position
86.40 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44586
Forward primer (5'-3')
TATGGAACTCTGCACTTGCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCCAGCACCTCCATCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 31910
Forward primer (5'-3')
TATGGAACTCTGCACTTGCG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AATCCAGCACCTCCATCAAG
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D782 marker 782
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)