SGN Marker SSR110

SGN-M783

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 42.857
Repeat motif: AT   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: TGTAACGTCAAACTTCAGGTG
Reverse primer: CTCCGCAATGTGTTGTATGG
Predicted size: 170
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43777)
Chromosome
9
Position
41.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44773
Forward primer (5'-3')
TGTAACGTCAAACTTCAGGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTCCGCAATGTGTTGTATGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43237)
Chromosome
9
Position
56.30 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44587
Forward primer (5'-3')
TGTAACGTCAAACTTCAGGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTCCGCAATGTGTTGTATGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40775)
Chromosome
9
Position
61.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39163)
Chromosome
9
Position
55.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31722
Forward primer (5'-3')
TGTAACGTCAAACTTCAGGTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTCCGCAATGTGTTGTATGG
Enzymes
  
Accessions and product sizes
Approximate temperature
42°C
  
Genomic location of SSR110  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D783 marker 783
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)