SGN Marker C2_At3g21300

SGN-M7831
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312048 (SGN)
126159 (CGN)
---
Lycopersicon CombinedSingleSGN-U236656---
Solanum tuberosumSingleSGN-U255930---
ArabidopsisSingleAt3g21300 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38500)
Chromosome
3
Position
159.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39729
Forward primer (5'-3')
TCAGGCCGGAATATTGAAACTGG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTGATAACAATGTCAGGCTTGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26262)
Chromosome
3
Position
7.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g21300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7831 marker 7831
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)