SGN Marker SSR112

SGN-M785

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 47.619
Repeat motif: AAT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GGAACACAACCAAGAAGTGGA
Reverse primer: TATCGGCTTAGGGTTGTTGG
Predicted size: 177
Derivations 
This marker was derived from EST read SGN-E84347
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39165)
Chromosome
9
Position
80.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14139
Forward primer (5'-3')
GGAACACAACCAAGAAGTGGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TATCGGCTTAGGGTTGTTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 176+177
Solanum pimpinellifolium LA1589: 177+179
Approximate temperature
50°C
  
Genomic location of SSR112  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D785 marker 785
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)