SGN Marker C2_At3g25120

SGN-M7870
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301759 (SGN)
123888 (CGN)
---
Lycopersicon CombinedSingleSGN-U218000---
ArabidopsisSingleAt3g25120 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41429)
Chromosome
6
Position
36.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43405
Forward primer (5'-3')
CCTTCCTCGGATCGAAAACATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCACTTGGATAGGCGACCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38513)
Chromosome
6
Position
5.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39737
Forward primer (5'-3')
AGCAAGTAGAACAGGAAAGCCTGATG
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
50°C
Reverse primer (5'-3')
AGCACTTGGATAGGCGACCATTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
275
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26302)
Chromosome
3
Position
9.15 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11147
Forward primer (5'-3')
AGCAAGTAGAACAGGAAAGCCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTTGGATAGGCGACCATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 11148
Forward primer (5'-3')
AGCAAGTAGAACAGGAAAGCCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTTGGATAGGCGACCATTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 11149
Forward primer (5'-3')
AGCAAGTAGAACAGGAAAGCCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTTGGATAGGCGACCATTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 11150
Forward primer (5'-3')
AGCAAGTAGAACAGGAAAGCCTGATG
Digested band sizes (using Hae)
Solanum pennellii LA716: 1000+840
Solanum lycopersicum LA925: 1000+650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTTGGATAGGCGACCATTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, TaqI, HaeIII, HinfI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1850
Solanum pennellii LA716: 1850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g25120F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At3g25120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7870 marker 7870
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)