SGN Marker C2_At3g27310

SGN-M7899
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple302073 (SGN)
119525 (CGN)
---
Lycopersicon CombinedSingleSGN-U219121---
Solanum tuberosumSingleSGN-U249469---
ArabidopsisSingleAt3g27310 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42223)
Chromosome
2
Position
104.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43789
Forward primer (5'-3')
AGCCCGAAGACTTCTATGAGTTCAC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TCTGCCTCACGAATTTTCTTCGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38521)
Chromosome
2
Position
138.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39743
Forward primer (5'-3')
AGCCCGAAGACTTCTATGAGTTCAC
Accessions and product sizes
Solanum pennellii TA56
250
Solanum lycopersicum TA209
250
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGCCTCACGAATTTTCTTCGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26332)
Chromosome
3
Position
10.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11162
Forward primer (5'-3')
AGCCCGAAGACTTCTATGAGTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCCTCACGAATTTTCTTCGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 11163
Forward primer (5'-3')
AGCCCGAAGACTTCTATGAGTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCCTCACGAATTTTCTTCGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 11164
Forward primer (5'-3')
AGCCCGAAGACTTCTATGAGTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCCTCACGAATTTTCTTCGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 11165
Forward primer (5'-3')
AGCCCGAAGACTTCTATGAGTTCAC
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 180+250
Solanum pennellii LA716: 430
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCCTCACGAATTTTCTTCGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,CfoI/HhaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 430
Solanum pennellii LA716: 430
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g27310F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g27310F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g27310  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7899 marker 7899
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)