SGN Marker TG296

SGN-M79

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTAGGTTTTTGTGTGGTTCAACGTTTTTGGTTTTGATTTTTATGTGTTTTCTTAGTTCCTTGCTTCACCATTTTGATGGTATTTTGAGTT
TTTGATGTTCTGTCGGCATAAAGTAGTGATTTTTCAGACAGTTTGGTATTATGGAGTATGTTTCTTTGCTCTTCTCTAATTTGGATTGGT
TCTGATTTGTATATGCTTGTTTTAGTTTCGATGGTTTTTGAGTTTTTGATGATTCATTGGCACAAAGTAGTGATTTTTCAGACTGTTGGG
TTTTGTGGGGTTCCCGTGCTTGCTCTTCACTAATTTGGATTGGTTCTGATTTGTATATGTTTTAGTTTTGATGGTTTTTGAGTTTTTGAT
GATTCATCGGCACAAAGTAGTGATCTTTCAGACAGTTGGGTTTTGTGGGGTTCACGTGCTTATTCTTCACTATTCTCGGTTGGTTTGATT
TGTAGGTCCGTTTTAGCAT
Reverse sequence
AGAATATAACAAAAAAGCAGATAAATCAGTTAATTATGCCTCAATCTCAACAAGTGAATAACAAATCCTATCAGAAGATATAGTAGACGA
TAAACAGTGAAGGTAGAAGCCTAACTCTATGACATTATCTTGAGACCCAAAACACTTCATCAAAGACTCAAAAGAAATAATTTGTTCACC
AAGTACTATTAACTAATTATCAAAACTAGAATTCTCAAAATAAAAAATAACAAATCTTATCAGTCACATGGACATTCATTAAACATCATG
AAGAAGACAACAAGGGAAGGTCAAAACTGGACTCCATGGCACATAAGATAATAACAAAAGGTAGTTTAAGGCCTAAAACACTTCAAAAAT
AAAATTTATTCACCAGATATCAATAATATTATCTGTTCTTCCTTCATTCATGAGGGGCATGCACAAGAGACAATATACATCATTTCTCCT
TTTACTTTTTCTTTCCTGAGGAAGTAAAAGGAGCAGAAAGCAGATAGAAAGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53257)
Chromosome
12
Position
51.13 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50367)
Chromosome
12
Position
63.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48301)
Chromosome
12
Position
94.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39984)
Chromosome
12
Position
96.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 7992)
Chromosome
12
Position
86.03 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7988)
Chromosome
12
Position
104.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7989)
Chromosome
12
Position
70.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7987)
Chromosome
12
Position
52.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG296 was used as an overgo probe on plate 4 [well F5]

Plausible BAC Matches:   P210G12,   P250O14

 Overgo Sequences

A sequence
CGGCACAAAGTAGTGATCTTTCAG
B sequence
CACAAAACCCAACTGTCTGAAAGA
AB sequence
CGGCACAAAGTAGTGATCTTTCAGACAGTT
Marker sequence
TTAGGTTTTTGTGTGGTTCAACGTTTTTGGTTTTGATTTTTATGTGTTTT
CTTAGTTCCTTGCTTCACCATTTTGATGGTATTTTGAGTTTTTGATGTTC
TGTCGGCATAAAGTAGTGATTTTTCAGACAGTTTGGTATTATGGAGTATG
TTTCTTTGCTCTTCTCTAATTTGGATTGGTTCTGATTTGTATATGCTTGT
TTTAGTTTCGATGGTTTTTGAGTTTTTGATGATTCATTGGCACAAAGTAG
TGATTTTTCAGACTGTTGGGTTTTGTGGGGTTCCCGTGCTTGCTCTTCAC
TAATTTGGATTGGTTCTGATTTGTATATGTTTTAGTTTTGATGGTTTTTG
AGTTTTTGATGATTCATCGGCACAAAGTAGTGATCTTTCAGACAGTTGGG
TTTTGTGGGGTTCACGTGCTTATTCTTCACTATTCTCGGTTGGTTTGATT
TGTAGGTCCGTTTTAGCAT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG296  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D79 marker 79
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)