SGN Marker C2_At3g43230

SGN-M7918
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304184 (SGN)
120662 (CGN)
---
Lycopersicon CombinedSingleSGN-U237360---
Solanum tuberosumSingleSGN-U249839---
ArabidopsisSingleAt3g43230 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38526)
Chromosome
7
Position
16.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41459
Forward primer (5'-3')
AGTGTGTGATACCTGCTATGATAGGCTTG
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
ACCGGGTATGGACCTCTCAGGATTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
275
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26351)
Chromosome
3
Position
15.22 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11172
Forward primer (5'-3')
ACGAAGGTCTGATGGTTCATGGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 11173
Forward primer (5'-3')
ACGAAGGTCTGATGGTTCATGGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 11174
Forward primer (5'-3')
ACGAAGGTCTGATGGTTCATGGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 12285
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12286
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12287
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12288
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12289
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12290
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12291
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12292
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12293
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12294
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12295
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12296
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33348
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33349
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33350
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33351
Forward primer (5'-3')
ACATCATTGTCGGTTTTGTGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAATCTGCGCACCCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 800
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g43230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7918 marker 7918
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)