Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker C2_At3g43540

SGN-M7921
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302556 (SGN)
125112 (CGN)
---
Lycopersicon CombinedSingleSGN-U228069---
Solanum tuberosumMultipleSGN-U260607---
ArabidopsisSingleAt3g43540 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109236)
Chromosome
8
Position
35.06 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38527)
Chromosome
8
Position
41.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39746
Forward primer (5'-3')
AGCTTACATGGCTACCACTACTTTCAC
Accessions and product sizes
Solanum lycopersicum TA209
430
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
AGACCAGAATCAGGCAACCCTGATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
430
Solanum pennellii TA56
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26354)
Chromosome
3
Position
15.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11175
Forward primer (5'-3')
AGCTTACATGGCTACCACTACTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCAGAATCAGGCAACCCTGATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11176
Forward primer (5'-3')
AGCTTACATGGCTACCACTACTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCAGAATCAGGCAACCCTGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11177
Forward primer (5'-3')
AGCTTACATGGCTACCACTACTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCAGAATCAGGCAACCCTGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11178
Forward primer (5'-3')
AGCTTACATGGCTACCACTACTTTCAC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCAGAATCAGGCAACCCTGATG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,HinfI,RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g43540F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g43540  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7921 marker 7921
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)