SGN Marker C2_At3g46780

SGN-M7933
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302624 (SGN)
123872 (CGN)
---
Lycopersicon CombinedMultipleSGN-U216750---
Solanum tuberosumSingleSGN-U247019---
ArabidopsisSingleAt3g46780 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46688)
Chromosome
2
Position
56.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46494)
Chromosome
2
Position
106.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42224)
Chromosome
6
Position
30.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43790
Forward primer (5'-3')
ATGGCTCCAACTCTTACTTCAAATTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGCATCTTGAAATGATGATGCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41436)
Chromosome
6
Position
46.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43412
Forward primer (5'-3')
TGGAGTTTCTGACCTTGGTGCTGC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TCTGCATCTTGAAATGATGATGCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38532)
Chromosome
6
Position
4.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39751
Forward primer (5'-3')
ATGGCTCCAACTCTTACTTCAAATTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCTGCATCTTGAAATGATGATGCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26367)
Chromosome
3
Position
17.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g46780  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7933 marker 7933
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)