SGN Marker C2_At3g47640

SGN-M7939
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303775 (SGN)
123879 (CGN)
---
Lycopersicon CombinedMultipleSGN-U215691---
Solanum tuberosumSingleSGN-U250225---
ArabidopsisSingleAt3g47640 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41437)
Chromosome
3
Position
126.70 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43413
Forward primer (5'-3')
AGCTGCTCGATTTGTAAAGGACATGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCCATACATCATTTGGAGTGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38534)
Chromosome
3
Position
128.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39753
Forward primer (5'-3')
AGCTGCTCGATTTGTAAAGGACATGC
Accessions and product sizes
Solanum pennellii TA56
220
Solanum lycopersicum TA209
220
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCCATACATCATTTGGAGTGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26373)
Chromosome
3
Position
17.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11190
Forward primer (5'-3')
AGCTGCTCGATTTGTAAAGGACATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCATACATCATTTGGAGTGGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11191
Forward primer (5'-3')
AGCTGCTCGATTTGTAAAGGACATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCATACATCATTTGGAGTGGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11192
Forward primer (5'-3')
AGCTGCTCGATTTGTAAAGGACATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCATACATCATTTGGAGTGGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11193
Forward primer (5'-3')
AGCTGCTCGATTTGTAAAGGACATGC
Digested band sizes (using XbaI)
Solanum pennellii LA716: 300+550
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCATACATCATTTGGAGTGGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: BstBI,CfoI/HhaI,PflMI,TaqI,XbaI
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g47640F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At3g47640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7939 marker 7939
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)