SGN Marker C2_At3g47990

SGN-M7944
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303934 (SGN)
120673 (CGN)
---
Capsicum annuumMultipleSGN-U200272---
Lycopersicon CombinedMultipleSGN-U234613---
Solanum tuberosumSingleSGN-U258835---
ArabidopsisSingleAt3g47990 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38535)
Chromosome
3
Position
101.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39754
Forward primer (5'-3')
AGAGAAGCAGTGGAGGCACTCATTC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
AGAAAACCTTGCAACCTCAGCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26378)
Chromosome
3
Position
17.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11199
Forward primer (5'-3')
AGAGAAGCAGTGGAGGCACTCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAAACCTTGCAACCTCAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11200
Forward primer (5'-3')
AGAGAAGCAGTGGAGGCACTCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAAACCTTGCAACCTCAGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11201
Forward primer (5'-3')
AGAGAAGCAGTGGAGGCACTCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAAACCTTGCAACCTCAGCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11202
Forward primer (5'-3')
AGAGAAGCAGTGGAGGCACTCATTC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 320+780
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAAACCTTGCAACCTCAGCAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,ApoI,BsaHI,BslI,EcoNI,HaeIII,HinfI,MspI,SsPI,TspRI
All possible enzymes for lycopersicum and pimpinellifolium: AhlI/BcuI/SpeI,BfaI/FspBI/MaeI/XspI
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g47990F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g47990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7944 marker 7944
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)