SGN Marker SSR122

SGN-M795

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: AG   Repeat number: 3
Repeat motif: AAG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: ACGGGATTGTACCCAATCAA
Reverse primer: AGGGTTTGAAGAGGAGGAGG
Predicted size: 172
Derivations 
This marker was derived from EST read SGN-E137592
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39168)
Chromosome
6
Position
101.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31942
Forward primer (5'-3')
ACGGGATTGTACCCAATCAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGGGTTTGAAGAGGAGGAGG
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Genomic location of SSR122  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D795 marker 795
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)