SGN Marker TG585

SGN-M8

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATTATCTCTGTGTTCATGATGTCTGGAAAGCCAGACACACAGAGATAGTGGCAACTTTATCAGTTCACCTACTGGTGTAGATAATTGTG
AAATCAGCTCGGTTGCTTCTTATCTCTTGGAATGCTCTGGTTATAATGATTGGTGAAAACATGGTTTTCTTATAACATCCTTGAACTGCT
AAAATGTTACTTTAAAAAATGATCTATTTCTTTTCGAAAAACTTCCTACATCATTGAGGAAATTGTAGAAAGAGAAGTTTATGGGGAGTA
AAACCTTTTGGCTGACAGGCTATTTCAGATAGGAGTCTAGGACTAAACTCTGCAAGTATGGATGCAAATATGCTAACAATTTTTTGAGCT
ACCTCCGTCGTTGGTGGCTACTTCTCTTGAAGATGATAGGATAAGAATGTCTTTCTGGAGACGTTCTAATTGTAGAAGCTCTTGATTTGT
ACTAGTCAGTATATATCTAACTTCCAACGGGTTGAAAATATTAGCACTGCCTACTGATACCCCTGC
Reverse sequence
TGAAGAAGGGTAGGGTTAAGTAATCATTGGTCGTGCCATGCACTCCCTCCGTTTCAGTTTGTTCATCTAGATTTGACTTGACACAGGGTT
TAGGTAAAGAAGACATTTAAATCTTATAATTTTAAACTTAAATATGTAAAATGTACCAAATGTCCTTCAATCTTGTGGCCTTAAACATGC
CAGGTAGAAAGTTAGAATTAAAGAGTTGCCAAAAAAGGAAAGAGGCATTCTTTTCAAAATGAACTAAAAAGAAAAGTAAGATAAACAAAT
TGAAACGGAGGGAGTAGCATTTATAATTACCAGTTCATCTGAACAATGGAAAAGCAGAAATTCTGAGTGCAATTAAATTATCAGTGGAGT
CAAAAACATACCTAAAGAATCCCGGTTTCTTGAGTTTTCTACCCGAACTATCATCAACTATTTATCAAAAAACACCAACTATCAGTTCAT
TTTTCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1451263.2e-0544 (9.6% of RFLP seq)-
SGN-U1672918.1e-0681 (17.8% of RFLP seq)-
SGN-U1719588.1e-0625 (5.5% of RFLP seq)-
SGN-U1585882.1e-0638 (8.3% of RFLP seq)-
SGN-U1469532.1e-0983 (18.2% of RFLP seq)-
SGN-U1680295.6e-13128 (28.1% of RFLP seq)-
SGN-U1651889.4e-18121 (26.5% of RFLP seq)-
SGN-U1554682.6e-2496 (21.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53571)
Chromosome
3
Position
5.02 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Eggplant-COSII   
Map version
63 (location: 42490)
Chromosome
3
Position
21.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40888)
Chromosome
3
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36589
Forward primer (5'-3')
TGGAAAGCCAGACACACAGA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACGACGGAGGTAGCTCAAAA
Digested band sizes (using DraI)
Solanum pennellii TA56
610
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40101)
Chromosome
3
Position
40.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7712)
Chromosome
3
Position
11.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 7714)
Chromosome
3
Position
24.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7713)
Chromosome
3
Position
18.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 14018
Forward primer (5'-3')
TGGAAAGCCAGACACACAGA
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 191+300
Solanum pennellii LA716: 491
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGGGGTATCAGTAGGCAGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 491
Solanum lycopersicum LA925: 491
Approximate temperature
55°C
  
PCR data   Exp. ID 14018
Forward primer (5'-3')
TGGAAAGCCAGACACACAGA
Digested band sizes (using HinfI)
Solanum pennellii LA716: 491
Solanum lycopersicum LA925: 191+300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGGGGTATCAGTAGGCAGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 491
Solanum lycopersicum LA925: 491
Approximate temperature
55°C
  
PCR data   Exp. ID 14091
Forward primer (5'-3')
TGGAAAGCCAGACACACAGA
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 191+350
Solanum pimpinellifolium LA1589: 560
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGGGGTATCAGTAGGCAGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 560
Solanum pimpinellifolium LA1589: 560
Approximate temperature
55°C
  
PCR data   Exp. ID 41
Forward primer (5'-3')
Unknown
Digested band sizes (using HinfI)
Solanum pennellii LA716: 491
Solanum lycopersicum LA925: 191+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 491
Solanum pennellii LA716: 491
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG585 was used as an overgo probe on plate 2 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGATGTCTGGAAAGCCAGACACAC
B sequence
AGTTGCCACTATCTCTGTGTGTCT
AB sequence
TGATGTCTGGAAAGCCAGACACACAGAGAT
Marker sequence
TATTATCTCTGTGTTCATGATGTCTGGAAAGCCAGACACACAGAGATAGT
GGCAACTTTATCAGTTCACCTACTGGTGTAGATAATTGTGAAATCAGCTC
GGTTGCTTCTTATCTCTTGGAATGCTCTGGTTATAATGATTGGTGAAAAC
ATGGTTTTCTTATAACATCCTTGAACTGCTAAAATGTTACTTTAAAAAAT
GATCTATTTCTTTTCGAAAAACTTCCTACATCATTGAGGAAATTGTAGAA
AGAGAAGTTTATGGGGAGTAAAACCTTTTGGCTGACAGGCTATTTCAGAT
AGGAGTCTAGGACTAAACTCTGCAAGTATGGATGCAAATATGCTAACAAT
TTTTTGAGCTACCTCCGTCGTTGGTGGCTACTTCTCTTGAAGATGATAGG
ATAAGAATGTCTTTCTGGAGACGTTCTAATTGTAGAAGCTCTTGATTTGT
ACTAGTCAGTATATATCTAACTTCCAACGGGTTGAAAATATTAGCACTGC
CTACTGATACCCCTGC

TG585 was used as an overgo probe on plate 1 [well E11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGATGTCTGGAAAGCCAGACACAC
B sequence
AGTTGCCACTATCTCTGTGTGTCT
AB sequence
TGATGTCTGGAAAGCCAGACACACAGAGAT
Marker sequence
TATTATCTCTGTGTTCATGATGTCTGGAAAGCCAGACACACAGAGATAGT
GGCAACTTTATCAGTTCACCTACTGGTGTAGATAATTGTGAAATCAGCTC
GGTTGCTTCTTATCTCTTGGAATGCTCTGGTTATAATGATTGGTGAAAAC
ATGGTTTTCTTATAACATCCTTGAACTGCTAAAATGTTACTTTAAAAAAT
GATCTATTTCTTTTCGAAAAACTTCCTACATCATTGAGGAAATTGTAGAA
AGAGAAGTTTATGGGGAGTAAAACCTTTTGGCTGACAGGCTATTTCAGAT
AGGAGTCTAGGACTAAACTCTGCAAGTATGGATGCAAATATGCTAACAAT
TTTTTGAGCTACCTCCGTCGTTGGTGGCTACTTCTCTTGAAGATGATAGG
ATAAGAATGTCTTTCTGGAGACGTTCTAATTGTAGAAGCTCTTGATTTGT
ACTAGTCAGTATATATCTAACTTCCAACGGGTTGAAAATATTAGCACTGC
CTACTGATACCCCTGC
Genomic location of TG585  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8 marker 8
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)