SGN Marker SSR128

SGN-M801

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: CAG   Repeat number: 6
Repeat motif: CAA   Repeat number: 3
Repeat motif: CAG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GGTCCAGTTCAATCAACCGA
Reverse primer: TGAAGTCGTCTCATGGTTCG
Predicted size: 123
Derivations 
This marker was derived from EST read SGN-E125201
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52834)
Chromosome
6
Position
31.69 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43780)
Chromosome
6
Position
41.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44777
Forward primer (5'-3')
GGTCCAGTTCAATCAACCGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAGTCGTCTCATGGTTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43240)
Chromosome
6
Position
41.40 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44591
Forward primer (5'-3')
GGTCCAGTTCAATCAACCGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAGTCGTCTCATGGTTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42987)
Chromosome
6
Position
18.20 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43987
Forward primer (5'-3')
GGTCCAGTTCAATCAACCGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAGTCGTCTCATGGTTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40778)
Chromosome
6
Position
37.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39171)
Chromosome
6
Position
35.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 80
Forward primer (5'-3')
GGTCCAGTTCAATCAACCGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAGTCGTCTCATGGTTCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 123+123
Solanum lycopersicum LA925: 106+123
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR128 was used as an overgo probe on plate 4 [well C11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGAGAGCTTGGCTAAGTTTCCTC
B sequence
GAGGAACCATTCCTACGAGGAAAC
AB sequence
TGGAGAGCTTGGCTAAGTTTCCTCGTAGGA
Marker sequence
TTTATGGAATAATTGCAATATGTTTGTCGCTTCAGCTCGTCAGCTTGCAA
AAGCTTTGGAAGTTCCGTTAGTAAATGATTTAGGATATACAAAGAGATAT
GTGAGATGCCTACAGATATCAGAGGTGGTTAATAGCATGAAAGATTTGAT
TGACTATAGCAGGGAGACGGGGACCGGACCCATGGAGAGCTTGGCTAAGT
TTCCTCGTAGGAATGGTTCCTCAGCTGGAGTACAAGGTCCAGTTCAATCA
ACCGAGGATCAGCAGCAGCAGCAGCAGCAGCAACAACAACAGCAGCAGCA
GCAGCAGCAACAACATACACATCAAACTGTCAATAGCTCGAACCATGAGA
CGACTTCACAGTCTGGTGTACCACCACTACCTTTGAGCAATGGTATGTCG
AATGTAAACAACTCTGTGAACCAAGTACCTGCTACTTCGTCTAGTGGTAC
TGTTGTTGGATTACTGCACCAAAATTCCATGAACTCCAGGCAACAAAATC
CTGTGAATGGTGGAAGTAGTACCTACTCANGAAATGCTGTCCAAATGCCT
TCCCCTAATTCT
Genomic location of SSR128  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D801 marker 801
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)