SGN Marker C2_At3g53580

SGN-M8014
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U196215---
Lycopersicon CombinedSingleSGN-U216727---
Solanum tuberosumSingleSGN-U247737---
ArabidopsisSingleAt3g53580 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46697)
Chromosome
7
Position
66.30 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38561)
Chromosome
9
Position
0.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41491
Forward primer (5'-3')
AGGGTTGACATGGGTGAGCCCATTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTTCAAACTTTGGACCAATGTCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26449)
Chromosome
3
Position
19.88 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g53580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8014 marker 8014
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)