SGN Marker C2_At3g54470

SGN-M8028
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304071 (SGN)
121896 (CGN)
---
Capsicum annuumSingleSGN-U197543---
Lycopersicon CombinedSingleSGN-U217894---
Solanum tuberosumMultipleSGN-U248357---
ArabidopsisSingleAt3g54470 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38565)
Chromosome
11
Position
72.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39766
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1200
Solanum pennellii TA56
1100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26463)
Chromosome
3
Position
20.18 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11240
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11241
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11242
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13312
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13313
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13314
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13315
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13316
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 550+650
Approximate temperature
55°C
  
PCR data   Exp. ID 13317
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13318
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13319
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13320
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 550+750
Approximate temperature
55°C
  
PCR data   Exp. ID 13321
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 550+750
Approximate temperature
55°C
  
PCR data   Exp. ID 13322
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33057
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33058
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 550+650
Approximate temperature
55°C
  
PCR data   Exp. ID 33059
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11243
Forward primer (5'-3')
TCCTGACTTTGGTTCTAAGCTTAGATCG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 450+225
Solanum pennellii LA716: 700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATATTAAGAAGTTGTGCTTGTCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI,RsaI,DraI,TaqI,RV,HaeIII,HinfI,DpnII,Kpni
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward sequence for 68, AB1 chromatogram - [View]
Forward sequence for 68, PDF chromatogram
Forward sequence for 68, plain text
3g54470Fhab-3g54470F.ab1, AB1 chromatogram - [View]
3g54470Fhab-3g54470F.pdf, PDF chromatogram
3g54470Fhab-3g54470F.txt, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g54470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8028 marker 8028
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)