SGN Marker C2_At3g54750

SGN-M8034
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312200 (SGN)
126648 (CGN)
---
Capsicum annuumSingleSGN-U201392---
Lycopersicon CombinedSingleSGN-U221610---
Solanum tuberosumSingleSGN-U253504---
ArabidopsisSingleAt3g54750 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38566)
Chromosome
1
Position
22.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41496
Forward primer (5'-3')
GTTTCATAGGTTGATCAATTGTGGC
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
2000
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCAAACCCCGGGTTGACTGAGA
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
950
Solanum pennellii TA56
900
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26469)
Chromosome
3
Position
20.28 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g54750  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8034 marker 8034
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)