SGN Marker C2_At3g54840

SGN-M8036
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310799 (SGN)
131176 (CGN)
---
Lycopersicon CombinedSingleSGN-U217508---
ArabidopsisSingleAt3g54840 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46700)
Chromosome
5
Position
77.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46499)
Chromosome
5
Position
71.00 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42229)
Chromosome
11
Position
28.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43795
Forward primer (5'-3')
CAACTACAGTTAAATTTGAAATATGGGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGCTTTGGCAAAAGACTCAGGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41446)
Chromosome
12
Position
28.90 cM
Confidence
I(LOD2)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43422
Forward primer (5'-3')
CATGTTCTTATATCATGTAACGTTTAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGCTTTGGCAAAAGACTCAGGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38569)
Chromosome
11
Position
20.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39768
Forward primer (5'-3')
TACTCTTGGGTGATTCTGGTGTTGG
Accessions and product sizes
Solanum pennellii TA56
225
Solanum lycopersicum TA209
250
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGCTTTGGCAAAAGACTCAGGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26472)
Chromosome
3
Position
20.33 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g54840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8036 marker 8036
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)