SGN Marker C2_At3g55120

SGN-M8040
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304733 (SGN)
124216 (CGN)
---
Lycopersicon CombinedMultipleSGN-U213694---
Solanum tuberosumSingleSGN-U246095---
ArabidopsisSingleAt3g55120 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38572)
Chromosome
5
Position
44.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39769
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
Accessions and product sizes
Solanum pennellii TA56
1500
Solanum lycopersicum TA209
1500
Approximate temperature
55°C
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300+320+850
Solanum lycopersicum TA209
300+1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26476)
Chromosome
3
Position
20.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11248
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 460
Approximate temperature
55°C
  
PCR data   Exp. ID 11249
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 460
Approximate temperature
55°C
  
PCR data   Exp. ID 11250
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 460
Approximate temperature
55°C
  
PCR data   Exp. ID 32415
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 460
Approximate temperature
53°C
  
PCR data   Exp. ID 32416
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 460
Approximate temperature
53°C
  
PCR data   Exp. ID 32417
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 460
Approximate temperature
53°C
  
PCR data   Exp. ID 32418
Forward primer (5'-3')
ATTCACTCGAGTGACTATGATCTTGCC
Digested band sizes (using BclI)
Solanum pennellii LA716: 460
Solanum lycopersicum LA925: 210+250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATGGAATCCAGCACTGCTTCTGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BclI,TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 460
Solanum pennellii LA716: 460
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g55120F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g55120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8040 marker 8040
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)