SGN Marker C2_At3g56130

SGN-M8056
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304612 (SGN)
124225 (CGN)
---
Lycopersicon CombinedMultipleSGN-U218181---
Solanum tuberosumSingleSGN-U248208---
ArabidopsisSingleAt3g56130 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41451)
Chromosome
6
Position
48.50 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43427
Forward primer (5'-3')
CTATCTTGTGTATGCCTTGTGAGCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGGATTTTCAAGACTTCTCCAGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38577)
Chromosome
6
Position
17.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39773
Forward primer (5'-3')
TCCAGTAGTGCCTGCGCCTGTTG
Accessions and product sizes
Solanum pennellii TA56
1800
Solanum lycopersicum TA209
1800
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGGATTTTCAAGACTTCTCCAGCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26492)
Chromosome
3
Position
20.84 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g56130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8056 marker 8056
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)