SGN Marker C2_At3g56210

SGN-M8058
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198508---
Lycopersicon CombinedSingleSGN-U223787---
Solanum tuberosumSingleSGN-U255069---
ArabidopsisSingleAt3g56210 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49259)
Chromosome
2
Position
36.48 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47195)
Chromosome
2
Position
59.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42230)
Chromosome
2
Position
21.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43796
Forward primer (5'-3')
ATGTCTTTGATTAAAGAGCAGTAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGGTAAAATGTTAATATTGTTATTATGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38578)
Chromosome
2
Position
55.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39774
Forward primer (5'-3')
ACAATCTGATGCAGCAGTCTGTCTCAC
Accessions and product sizes
Solanum pennellii TA56
1250
Solanum lycopersicum TA209
1250
Approximate temperature
58°C
Reverse primer (5'-3')
TCTTGAAATCTACTCAGCAAATTTGAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
975
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26494)
Chromosome
3
Position
20.87 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g56210  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8058 marker 8058
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)