Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker C2_At3g56230

SGN-M8059
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308279 (SGN)
128733 (CGN)
---
Lycopersicon CombinedSingleSGN-U228008---
Solanum tuberosumSingleSGN-U257353---
ArabidopsisSingleAt3g56230 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38579)
Chromosome
6
Position
18.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39775
Forward primer (5'-3')
ATGCTCCTTCTATACCAGCACATAGAG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGAGGATTCTTGAGTGCAAATGCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26495)
Chromosome
3
Position
20.87 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g56230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8059 marker 8059
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)