SGN Marker C2_At3g57050

SGN-M8068
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302140 (SGN)
120418 (CGN)
---
Lycopersicon CombinedSingleSGN-U219945---
ArabidopsisSingleAt3g57050 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26504)
Chromosome
3
Position
21.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41509
Forward primer (5'-3')
TGCCTGTAAACTTTCCAGTGACATTTGG
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
ACACTTGGCTCTTTTGCTTCCCTAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11273
Forward primer (5'-3')
ACACGGAGTGGAAATCCAACAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGGTAAAGCAAAATGCTCGATCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11274
Forward primer (5'-3')
ACACGGAGTGGAAATCCAACAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGGTAAAGCAAAATGCTCGATCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11275
Forward primer (5'-3')
ACACGGAGTGGAAATCCAACAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGGTAAAGCAAAATGCTCGATCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g57050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8068 marker 8068
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)