SGN Marker SSR134

SGN-M807

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40.909 High: 50
Repeat motif: TA   Repeat number: 20
Repeat motif:    Repeat number:
Forward primer: CCCTCTTGCCTAAACATCCA
Reverse primer: CGTTGCGAATTCAGATTAGTTG
Predicted size: 171
Derivations 
This marker was derived from EST read SGN-E31067
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43781)
Chromosome
1
Position
62.20 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44779
Forward primer (5'-3')
CCCTCTTGCCTAAACATCCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CGTTGCGAATTCAGATTAGTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43241)
Chromosome
1
Position
64.30 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44593
Forward primer (5'-3')
CCCTCTTGCCTAAACATCCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CGTTGCGAATTCAGATTAGTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40779)
Chromosome
1
Position
75.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39173)
Chromosome
1
Position
43.30 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14078
Forward primer (5'-3')
CCCTCTTGCCTAAACATCCA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGTTGCGAATTCAGATTAGTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 171+157
Solanum lycopersicum LA925: 171+172
Approximate temperature
50°C
  
Genomic location of SSR134  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D807 marker 807
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)