SGN Marker C2_At3g57280

SGN-M8072
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306826 (SGN)
132290 (CGN)
---
Lycopersicon CombinedSingleSGN-U218368---
Solanum tuberosumSingleSGN-U249054---
ArabidopsisSingleAt3g57280 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38581)
Chromosome
10
Position
52.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39777
Forward primer (5'-3')
TAAGCAGTGGTGTTCTTTTTGGAGG
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCTTCAACTTCTTCTTAGGTGGTGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26508)
Chromosome
3
Position
21.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g57280  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8072 marker 8072
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)