SGN Marker C2_At3g58790

SGN-M8087
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303091 (SGN)
125009 (CGN)
---
Capsicum annuumSingleSGN-U200151---
Lycopersicon CombinedSingleSGN-U220366---
ArabidopsisSingleAt3g58790 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46706)
Chromosome
7
Position
10.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41453)
Chromosome
7
Position
97.20 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43429
Forward primer (5'-3')
ACTGGGGAAGAAGTGTTATGCACTTAGGC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TGGCTTGGCTGGTCCACTGAAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38586)
Chromosome
7
Position
44.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39781
Forward primer (5'-3')
ATCATCTAAGTTGGATTATGATCGTTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGCTTGGCTGGTCCACTGAAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26524)
Chromosome
3
Position
21.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g58790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8087 marker 8087
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)