SGN Marker C2_At3g60830

SGN-M8107
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302241 (SGN)
122924 (CGN)
---
Lycopersicon CombinedSingleSGN-U219505---
Solanum tuberosumMultipleSGN-U258839---
ArabidopsisSingleAt3g60830 on TAIR---
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53428)
Chromosome
11
Position
14.75 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Pepper-COSII   
Map version
58 (location: 41454)
Chromosome
12
Position
27.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43430
Forward primer (5'-3')
ATGCTGGTTCTAAATTTCTCAAAGC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
ATATGCGTCCAACTGCATAAAGCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38589)
Chromosome
11
Position
21.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39783
Forward primer (5'-3')
ATGCTGGTTCTAAATTTCTCAAAGC
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
530
Approximate temperature
55°C
Reverse primer (5'-3')
ATATGCGTCCAACTGCATAAAGCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
530
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26544)
Chromosome
3
Position
22.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11288
Forward primer (5'-3')
ATGCTGGTTCTAAATTTCTCAAAGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ATATGCGTCCAACTGCATAAAGCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11289
Forward primer (5'-3')
ATGCTGGTTCTAAATTTCTCAAAGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ATATGCGTCCAACTGCATAAAGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11290
Forward primer (5'-3')
ATGCTGGTTCTAAATTTCTCAAAGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ATATGCGTCCAACTGCATAAAGCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11291
Forward primer (5'-3')
ATGCTGGTTCTAAATTTCTCAAAGC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 900+1100
Solanum pennellii LA716: 2000
Mg+2 concentration
3mM
Reverse primer (5'-3')
ATATGCGTCCAACTGCATAAAGCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,ApaI,ApoI,AseI,AvaII,BanII,BslI,BsoBI,BstNI,DraI,EcoO109I,HaeIII,HindIII,HinfI,Hpy188I,NciI,Sau96I,ScrFI,XmnI
All possible enzymes for lycopersicum and pimpinellifolium: AluI,ApaI,ApoI,AseI,AvaII,BanII,BsiHKAI,BslI,BsoBI,BstNI,DraI,EcoO109I,HaeIII,HindIII,Hpy188I,MspI,NciI,SacI,Sau96I,ScrFI,XmnI
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g60830F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g60830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8107 marker 8107
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)