SGN Marker C2_At3g61140

SGN-M8109
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302504 (SGN)
123277 (CGN)
---
Capsicum annuumSingleSGN-U204154---
Lycopersicon CombinedMultipleSGN-U219443---
Solanum tuberosumSingleSGN-U249368---
ArabidopsisSingleAt3g61140 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41455)
Chromosome
1
Position
87.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43431
Forward primer (5'-3')
AGCCGACGAGATCTACGCCAACG
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
AACATAATTCTTAAATGCCTCTCCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38590)
Chromosome
1
Position
62.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39784
Forward primer (5'-3')
AGCCGACGAGATCTACGCCAACG
Accessions and product sizes
Solanum lycopersicum TA209
700
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
AACATAATTCTTAAATGCCTCTCCAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
700
Solanum lycopersicum TA209
300+400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26546)
Chromosome
3
Position
22.64 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11292
Forward primer (5'-3')
AGCCGACGAGATCTACGCCAACG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AACATAATTCTTAAATGCCTCTCCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 11293
Forward primer (5'-3')
AGCCGACGAGATCTACGCCAACG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AACATAATTCTTAAATGCCTCTCCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 11294
Forward primer (5'-3')
AGCCGACGAGATCTACGCCAACG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AACATAATTCTTAAATGCCTCTCCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: Multiple
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g61140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8109 marker 8109
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)