SGN Marker C2_At3g62940

SGN-M8125
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309811 (SGN)
126985 (CGN)
---
Lycopersicon CombinedMultipleSGN-U214395---
Solanum tuberosumSingleSGN-U264154---
ArabidopsisSingleAt3g62940 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49261)
Chromosome
4
Position
50.58 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47197)
Chromosome
4
Position
35.62 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42232)
Chromosome
11
Position
52.50 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43798
Forward primer (5'-3')
ACCTGTGATAAGTAATCATGTTTACCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGCTCTCTGGCTGCCTCTTGTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38595)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39787
Forward primer (5'-3')
ACCCGCGAGGAGATGCTTTCTAGG
Accessions and product sizes
Solanum lycopersicum TA209
320
Solanum pennellii TA56
320
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGCTCTCTGGCTGCCTCTTGTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
320
Solanum lycopersicum TA209
260
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26562)
Chromosome
3
Position
23.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11302
Forward primer (5'-3')
ACCCGCGAGGAGATGCTTTCTAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCTCTCTGGCTGCCTCTTGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11303
Forward primer (5'-3')
ACCCGCGAGGAGATGCTTTCTAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCTCTCTGGCTGCCTCTTGTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11304
Forward primer (5'-3')
ACCCGCGAGGAGATGCTTTCTAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCTCTCTGGCTGCCTCTTGTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11305
Forward primer (5'-3')
ACCCGCGAGGAGATGCTTTCTAGG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 400+500
Solanum lycopersicum LA925: 300+500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGCTCTCTGGCTGCCTCTTGTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII,SsPI,TaqI,XbaI
All possible enzymes for lycopersicum and pimpinellifolium: SsPI
  
Accessions and product sizes
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g62940F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g62940F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g62940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8125 marker 8125
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)