SGN Marker C2_At4g00090

SGN-M8138
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301281 (SGN)
119452 (CGN)
---
Capsicum annuumSingleSGN-U201719---
Lycopersicon CombinedSingleSGN-U223776---
Solanum tuberosumMultipleSGN-U246208---
ArabidopsisSingleAt4g00090 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49264)
Chromosome
1
Position
76.72 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47201)
Chromosome
1
Position
61.02 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46708)
Chromosome
1
Position
51.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38601)
Chromosome
1
Position
57.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39792
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
190
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26575)
Chromosome
4
Position
0.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11317
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11318
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11319
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13351
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13352
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750+1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13353
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13354
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13355
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13356
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13357
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 750+1700
Approximate temperature
55°C
  
PCR data   Exp. ID 13358
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13359
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13360
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13361
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13362
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 33076
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33077
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33078
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11320
Forward primer (5'-3')
AGATATTGGCCACCACTCATGGTTC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 350+420
Solanum lycopersicum LA925: 290+420
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCGACCATGCCATGTCCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
All possible enzymes for lycopersicum and pimpinellifolium: RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g00090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8138 marker 8138
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)