SGN Marker C2_At4g00560

SGN-M8140
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304798 (SGN)
121715 (CGN)
---
Lycopersicon CombinedMultipleSGN-U219946---
Solanum tuberosumSingleSGN-U248354---
ArabidopsisSingleAt4g00560 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41457)
Chromosome
1
Position
171.60 cM
Confidence
I(LOD2)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43433
Forward primer (5'-3')
AGCGCCTACTGGAAGCCATTCCTC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
ACAGAAAGTGCAGCACAATTAACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38602)
Chromosome
1
Position
69.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39793
Forward primer (5'-3')
AGCGCCTACTGGAAGCCATTCCTC
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
2000
Approximate temperature
55°C
Reverse primer (5'-3')
ACAGAAAGTGCAGCACAATTAACCAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
900+1100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26577)
Chromosome
4
Position
0.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11321
Forward primer (5'-3')
AGCGCCTACTGGAAGCCATTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGTGCAGCACAATTAACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11322
Forward primer (5'-3')
AGCGCCTACTGGAAGCCATTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGTGCAGCACAATTAACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11323
Forward primer (5'-3')
AGCGCCTACTGGAAGCCATTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGTGCAGCACAATTAACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11324
Forward primer (5'-3')
AGCGCCTACTGGAAGCCATTCCTC
Digested band sizes (using BslI)
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGTGCAGCACAATTAACCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BslI
All possible enzymes for lycopersicum and pimpinellifolium: AluI,TspRI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g00560F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At4g00560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8140 marker 8140
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)