SGN Marker C2_At4g01650

SGN-M8151
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301254 (SGN)
120986 (CGN)
---
Lycopersicon CombinedSingleSGN-U223320---
ArabidopsisSingleAt4g01650 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26588)
Chromosome
4
Position
0.71 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41531
Forward primer (5'-3')
ATGGGGAAGAATCGTCGGAGG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTCAAAATTTTTGAAGTCACCTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g01650  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8151 marker 8151
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)