SGN Marker C2_At4g01900

SGN-M8157
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple309382 (SGN)
130767 (CGN)
---
Capsicum annuumSingleSGN-U196907---
Lycopersicon CombinedSingleSGN-U215766---
Solanum tuberosumMultipleSGN-U246942---
ArabidopsisSingleAt4g01900 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49266)
Chromosome
6
Position
3.33 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47203)
Chromosome
6
Position
5.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41460)
Chromosome
6
Position
0.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43436
Forward primer (5'-3')
GAGTTTTAGTGCATCGGACTGCTTTA
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGGGCGCCAAAACCACGAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38607)
Chromosome
6
Position
8.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39798
Forward primer (5'-3')
TCACTTTCAAAATCCAATTTCTCC
Accessions and product sizes
Solanum pennellii TA56
550+850
Solanum lycopersicum TA209
550+1400
Approximate temperature
53°C
Reverse primer (5'-3')
TGGGCGCCAAAACCACGAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
550+850
Solanum lycopersicum TA209
550+1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26594)
Chromosome
4
Position
0.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32423
Forward primer (5'-3')
TCACTTTCAAAATCCAATTTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGCGCCAAAACCACGAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32424
Forward primer (5'-3')
TCACTTTCAAAATCCAATTTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGCGCCAAAACCACGAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32425
Forward primer (5'-3')
TCACTTTCAAAATCCAATTTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGCGCCAAAACCACGAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32426
Forward primer (5'-3')
TCACTTTCAAAATCCAATTTCTCC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 700+725
Solanum lycopersicum LA925: 300+1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGCGCCAAAACCACGAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g01900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8157 marker 8157
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)