SGN Marker C2_At4g03020

SGN-M8175
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198346---
Lycopersicon CombinedMultipleSGN-U215943---
Solanum tuberosumSingleSGN-U248001---
ArabidopsisSingleAt4g03020 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26612)
Chromosome
4
Position
1.33 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41538
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
Accessions and product sizes
Solanum lycopersicum TA209
800
Solanum pennellii TA56
800
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCTTAGTAAGTTGAGAAATTTCATGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
290+420
Solanum pennellii TA56
350+420
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11344
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGCTTAGTAAGTTGAGAAATTTCATGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
53°C
  
PCR data   Exp. ID 11345
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGCTTAGTAAGTTGAGAAATTTCATGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
53°C
  
PCR data   Exp. ID 11346
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGCTTAGTAAGTTGAGAAATTTCATGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
53°C
  
PCR data   Exp. ID 12309
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12310
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12311
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12312
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12313
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 12314
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 12315
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 12316
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12317
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 12318
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 33356
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33357
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 33358
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580+850
Approximate temperature
55°C
  
PCR data   Exp. ID 33359
Forward primer (5'-3')
AGACACCGGACTCTTTGATGGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGTTGATCCGGAGAAAGAGATGTATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 580+850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g03020  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8175 marker 8175
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)