SGN Marker C2_At4g03180

SGN-M8180
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302902 (SGN)
119735 (CGN)
---
Lycopersicon CombinedMultipleSGN-U234641---
Solanum tuberosumSingleSGN-U248645---
ArabidopsisSingleAt4g03180 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38613)
Chromosome
6
Position
101.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39802
Forward primer (5'-3')
TGGATGTGGATAAGAAGAAGAATATGC
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTACTTCATGACTGGTTGGCCTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250+350
Solanum pennellii TA56
220+500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26617)
Chromosome
4
Position
1.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g03180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8180 marker 8180
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)