SGN Marker C2_At4g03400

SGN-M8183
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203316---
Solanum tuberosumSingleSGN-U247907---
ArabidopsisSingleAt4g03400 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41464)
Chromosome
10
Position
44.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43440
Forward primer (5'-3')
TGCTATGGAATCACTTTATGCTACTATGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTTCTGTCTTCCCTCTGTGGTTCCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38617)
Chromosome
10
Position
19.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41540
Forward primer (5'-3')
TGCTATGGAATCACTTTATGCTACTATGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATTTCTGTCTTCCCTCTGTGGTTCCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26621)
Chromosome
4
Position
1.50 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g03400  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8183 marker 8183
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)