SGN Marker C2_At4g03560

SGN-M8184
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307465 (SGN)
126572 (CGN)
---
Capsicum annuumSingleSGN-U200812---
Lycopersicon CombinedSingleSGN-U240130---
ArabidopsisSingleAt4g03560 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26622)
Chromosome
4
Position
1.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41541
Forward primer (5'-3')
TCCGTTCTCCTGGTCAATCTTGTTG
Accessions and product sizes
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1300
Approximate temperature
50°C
Reverse primer (5'-3')
AGGGGCTACAAAAGTAGCTGTTTCTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
600+700
Solanum pennellii TA56
1400
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g03560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8184 marker 8184
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)