SGN Marker C2_At4g04955

SGN-M8188
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202505---
Lycopersicon CombinedSingleSGN-U214730---
Solanum tuberosumMultipleSGN-U244142---
ArabidopsisSingleAt4g04955 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46712)
Chromosome
2
Position
6.20 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42236)
Chromosome
2
Position
47.10 cM
Confidence
F(LOD3)
Protocol
PCR


Eggplant-COSII

PCR data   Exp. ID 43802
Forward primer (5'-3')
TTGCTGTGGGGAACCAAGCAGATATAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCAGAGAGTCTTGATCCCATGTATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41465)
Chromosome
2
Position
76.10 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43441
Forward primer (5'-3')
TTGCTGTGGGGAACCAAGCAGATATAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GATCCCATGTATGCAGAAATACTCGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38619)
Chromosome
2
Position
63.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41542
Forward primer (5'-3')
TTGCTGTGGGGAACCAAGCAGATATAG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCAGAGAGTCTTGATCCCATGTATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26626)
Chromosome
4
Position
2.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g04955  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8188 marker 8188
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)