SGN Marker C2_At4g05090

SGN-M8189
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304809 (SGN)
119758 (CGN)
---
Lycopersicon CombinedSingleSGN-U242892---
Solanum tuberosumMultipleSGN-U247864---
ArabidopsisSingleAt4g05090 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109240)
Chromosome
2
Position
52.32 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38620)
Chromosome
2
Position
69.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39807
Forward primer (5'-3')
AGTATTATAGCGAGCTCGAAGCTGC
Accessions and product sizes
Solanum lycopersicum TA209
425
Solanum pennellii TA56
425
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTTCCCCCTCTGTCAATTGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
425
Solanum lycopersicum TA209
325
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26627)
Chromosome
4
Position
2.61 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32440
Forward primer (5'-3')
AGTATTATAGCGAGCTCGAAGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCCCCCTCTGTCAATTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32441
Forward primer (5'-3')
AGTATTATAGCGAGCTCGAAGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCCCCCTCTGTCAATTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32442
Forward primer (5'-3')
AGTATTATAGCGAGCTCGAAGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCCCCCTCTGTCAATTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32443
Forward primer (5'-3')
AGTATTATAGCGAGCTCGAAGCTGC
Digested band sizes (using HincII)
Solanum lycopersicum LA925: 250+1050
Solanum pennellii LA716: 1300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCCCCCTCTGTCAATTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g05090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8189 marker 8189
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)