SGN Marker SSR146

SGN-M819

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 55.556
Repeat motif: AT   Repeat number: 7
Repeat motif: CAT   Repeat number: 5
Repeat motif:    Repeat number:
Forward primer: TATGGCCATGGCTGAACC
Reverse primer: CGAACGCCACCACTATACCT
Predicted size: 243
Derivations 
This marker was derived from EST read SGN-E66860
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39177)
Chromosome
4
Position
102.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 66
Forward primer (5'-3')
TATGGCCATGGCTGAACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CGAACGCCACCACTATACCT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 239+243
Solanum lycopersicum LA925: 243+243
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR146 was used as an overgo probe on plate 7 [well A7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGATTCTTCTCCAGGTGACTTTAC
B sequence
AGTACCCAGATCGCTAGTAAAGTC
AB sequence
CGATTCTTCTCCAGGTGACTTTACTAGCGA
Marker sequence
CAAAGTGAGAACAAGTATGGCCATGGCTGAACCACCATCATCATCATCAT
ATATATATATATATAAAGAAACTGCAAAATAACATTATTTTATCACTACA
TATATCGAGGAAAGAAAAACACCCAAGATAAAAAGATTTCAAATTTTTAG
CTTCGAATTTCAAAATTTGGGGAAATTTGAGGATATGGGGTTTTGGGGGA
AAGTATTATTGGGGAAGAAAAGAGAGAGGAAAAGTTGAAGGTATAGTGGT
GGCGTTCGCATGGATGACAAGTAAAGATCGATACGTCAACAACTATGTAG
ATCTCTACTCATCTCTTGGATGGAAATCCCTTGTTCGTCACTCTCAATTT
CGTAATATGTTTTTTCCTGATAAAGCTGCATCACTGGCAGCAGAGATTGT
GAACGAGCTTGTTAAGGAGCTTAAAGTTAGACCATGCCCTGTTGTCTTTG
CATCTTTTTCAGGTGGACCCAAAGCATGCATGTATAAGGTTCTCCAGATA
ATCGAGGGCAAATATGAAGAACATACCAATCTGGGTGAGTTCCGACTTGT
TAGAGACTGTCTTTCGGGCTACATTTTCGATTCTTCTCCAGGTGACTTTA
CTAGCGATCTGGGTACTAAATTTATACT
Genomic location of SSR146  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D819 marker 819
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)